Neurons in Brainstem Insensitive to Etoh, Pentobarbital 1

During hibernation in the 13-lined ground squirrel, Ictidomys tridecemlineatus, the cerebral cortex is electrically silent, yet the brainstem continues to regulate cardiorespiratory function. Previous work showed that neurons in slices through the medullary ventral respiratory column (VRC) but not the cortex, are insensitive to high doses of pentobarbital during hibernation, leading to the hypothesis that GABAA receptors (GABAAR) in the VRC undergo a seasonal modification in subunit composition. To test whether alteration of GABAAR subunits are responsible for hibernation-associated pentobarbital insensitivity, we examined an array of subunits using RT-PCR and Western blot, and identified changes in ε and δ subunits in the medulla, but not the cortex. Using immunohistochemistry, we confirmed that during hibernation, the expression of ε subunit-containing GABAARs nearly doubles in the VRC. We also identified a population of δ subunit-containing GABAARs adjacent to the VRC that were differentially expressed during hibernation. As δ subunit-containing GABAARs are particularly sensitive to ethanol (ETOH), multichannel electrodes were inserted in slices of medulla and cortex from hibernating squirrels and ETOH applied. ETOH, which normally inhibits neuronal activity, excited VRC but not cortical neurons during hibernation. This excitation was prevented by bicuculline pretreatment indicating the involvement of GABAARs. We propose that neuronal activity in the VRC during hibernation is unaffected by pentobarbital due to upregulation of ε subunit-containing GABAARs on VRC neurons. Synaptic input from adjacent inhibitory interneurons that Neurons in brainstem insensitive to ETOH, pentobarbital 3 express δ subunit-containing GABAARs are responsible for the excitatory effects of ETOH on VRC neurons during hibernation. Neurons in brainstem insensitive to ETOH, pentobarbital 4 INTRODUCTION Hibernating animals provide a natural model with which to investigate mechanisms of circuit-specific neuronal plasticity. During torpor (body temperature (Tb) = 4°C) the forebrain is isoelectric (54), and dendritic processes of neurons in the cortex, hippocampus and thalamus retract (51, 52). In contrast, neuronal control of respiratory function is maintained during torpor (34). Throughout hibernation, between torpor bouts (3-21 days), squirrels spontaneously re-warm (Tb=37°C) and resume activity for <24h. Previous work in our laboratory has shown that during these arousals (interbout arousal), neurons in the ventral respiratory column (VRC) are insensitive to high doses of barbiturates (22). In contrast, cortical neurons are highly sensitive to the inhibitory effects of pentobarbital throughout the year. Similarly, VRC neurons in squirrels are sensitive to pentobarbital during the summer active months. Sensitivity to muscimol, a GABA receptor agonist, is unchanged in both VRC and cortex throughout the year, indicating the presence of fully-functional GABA receptors. As barbiturates are potent allosteric positive modulators of GABAA receptors, circuit-specific alterations in GABAARs are likely to be responsible for the pentobarbital insensitivity in this medullary brain region during hibernation. The VRC is a column of neurons extending through the ventrolateral medulla that encompasses the essential rhythm and pattern generating circuitry of the respiratory control system (2). The VRC consists of the Bötzinger region in the rostral medulla, the pre-Bötzinger complex (preBötC) and the rostral ventral respiratory group (rVRG) to the caudal ventral respiratory group (cVRG) in the caudal medulla. Identification of the VRC Neurons in brainstem insensitive to ETOH, pentobarbital 5 in squirrel is based on anatomical landmarks with reference to rat (37). Findings in squirrel suggest that medullary GABAA receptors are involved in preserving respiratory function during the extreme conditions that define mammalian hibernation (22). However, the specific molecular changes that take place in GABAARs in respiratory brain regions during hibernation are unknown. GABAARs are pentameric and typically composed of α1(2), β2(2), and γ2 subunits. Two molecules of GABA bind the receptor at junctions of the α and β subunits, while the γ2 subunit facilitates post-synaptic localization (4). Thus far, 19 GABAAR subunits have been found in nature (12). While the predominant GABAAR found throughout the rodent brain is the α1β2γ2 subtype, there are regionally localized subtypes that incorporate other subunits (39). GABAAR subtypes can help to define distinct neuronal circuits, subcellular localization, and pharmacokinetics, thereby contributing to unique circuit characteristics (41, 44). Subunit substitutions can radically alter cellular and network responses to GABAAR modulators. For example, when the δ subunit is inserted in place of γ2, GABAARs are predominantly extrasynaptic and display increased sensitivity to allosteric modulators, especially ethanol (ETOH) (21), so much that they have been termed “a target for alcohol” (47). Less well understood is the ε subunit, whose function and natural expression patterns are largely unknown. Transfection of the ε subunit results in GABAARs that are insensitive to pentobarbital, propofol, and benzodiazepines (13, 14, 23), yet a natural role for the ε subunit has not yet been established. Neurons in brainstem insensitive to ETOH, pentobarbital 6 There are three potential hypotheses to explain the previously reported pentobarbital insensitivity in VRC neurons during hibernation (22). First, there is insertion of ε subunit-containing GABAARs into VRC neurons during hibernation. Second, there is a decrease in δ subunit-containing GABAARs during hibernation. A third explanation as to how VRC neurons could become seasonally insensitive to pentobarbital is by changes in GABAA receptor subtypes on neurons that project to VRC neurons. Each of these hypotheses can be tested with molecular, electrophysiological and pharmacological approaches. For example, insertion of δ subunit-containing GABAARs on inhibitory interneurons projecting to VRC neurons would result in an excitatory response to ethanol (ETOH). We used several different techniques to test these hypotheses, including quantitative RT-PCR, Western blot, immunohistochemistry, and multichannel recording from brain slices, recognizing the challenges associated with such studies in squirrel. Based on our findings, we propose a model of GABAAR distribution (involving receptors expressing ε and δ subunits) that explains how VRC neurons may become seasonally insensitive to lethal doses of barbiturate. These findings hint at a solution for the problem of how medullary networks involved in cardiorespiratory control remain active during hibernation while most other (higher) brain regions are functionally switched off for energy conservation. Neurons in brainstem insensitive to ETOH, pentobarbital 7 MATERIALS AND METHODS Ethical Approval All experimental procedures were in accordance with NIH guidelines and approved by the University of Wisconsin-Madison Institutional Animal Care and Use Committee. Experimental Animals Thirteen-lined ground squirrels (Ictidomys tridecemlineatus) were trapped in and around Madison, Wisconsin, between May and September. Animals were housed individually with access to food and water ad libitum. From May through September animals were maintained at an ambient temperature of 22 ̊C with a 12 h:12 h light-dark cycle (summer active, SA). In September-February, animals were housed in a dark room maintained at 4 ̊C to facilitate hibernation. Seasonal hibernation is characterized by extended periods of time (3-21 days) spent in the torpid, hypometabolic state (torpor, T), punctuated by a rapid return (~2 h) to normothermia lasting for approximately 12 h (interbout arousal, IBA) prior to re-entering torpor (10, 27). Food and water were removed after approximately two wk of torpor/arousal cycles. During IBA, animals were active but did not eat or drink. All hibernating animals completed at least four full torpor bouts prior to being used in experiments. Torpor duration was monitored daily by the sawdust method (9). Briefly, animals were covered in sawdust upon entrance into torpor, and checked every 24h for either arousal (IBA) or a disruption of sawdust, indicating an arousal and re-entrance into torpor since the last observation. Tb was measured with a rectal thermometer upon decapitation. Tb of torpid hibernators was 3-9 ̊C, 35-38 ̊C for IBA Neurons in brainstem insensitive to ETOH, pentobarbital 8 hibernators, and 36-38 ̊C for summer active animals. A total of 104 squirrels was used in the following experiments. Tissue Collection Brain tissue was collected from SA, T, and IBA animals. Animals (SA, IBA) were deeply anesthetized with isoflurane and sacrificed by decapitation; T animals were placed in a cooled chamber and exposed to 5% isoflurane for 5 min prior to decapitation. The medulla (between C1 and the pons) was harvested. Cortical samples (CTX), including primary motor and somatosensory areas centered on a region equivalent to Bregma -3.24 mm in rat (37), were harvested simultaneously (Fig. 1A). In a separate group of animals, tissues punches (diameter=0.75 mm, depth=0.75 mm; Stoelting, Wood Dale, IL) were taken from CTX, and two medullary regions previously reported to be seasonally insensitive to sodium pentobarbital, the VRC and the nucleus of the solitary tract (NTS) (22). Punches were taken from 3 slices (thickness = 750 μm) through the medulla inclusive of the BötC, and extending through the cVRG (Fig. 1B). Tissue samples for Western blot were homogenized in buffer (65 mM TrisHCl, pH 7.4, 0.108 M NaCl, 0.05 M NaF, protease inhibitor [Roche, Indianapolis, IN], 2.57 mM EDTA, 0.5% Triton X100) and stored at -80 ̊C. Total protein concentration of each extract was measured using a Nanodrop (Fisher Scientific, Waltham, MA). Western Blot Cortical and medullary lysates were subjected to SDS PAGE by separating 30 μg protein per lane on 12% gels. Proteins were transferred to 0.2 μm nitrocellulose membrane Neurons in brainstem insensitive to ETOH, pentobarbital 9 (Sigma-Aldrich, St. Louis, MO), blocked in Tris-buffered saline with Tween-20 (TBST) (50 mM Tris-HCl, pH 7.5, 15 mM NaCl, 0.5% Tween-20) containing 5% Blotto (Santa Cruz Biotechnology, Santa Cruz, CA), washed in TBST, and incubated at 4 ̊C overnight in TBST containing 1% Blotto and primary antibody (anti-GABAA δ 1:1000, AB9752, Millipore, Billerica, MA; anti-GABAA ε 1:500, 1:1000, 1:5000, ab35971, Abcam; antiGABAA α1 1:1000, PRB-564P, Covance, Emeryville, CA; anti-GABAA γ2 1:1000, PRB569C, Covance, Emeryville, CA). Subsequently, membranes were washed in TBST and incubated for 1.0 h in TBST containing 1% Blotto and secondary antibody (goat antirabbit or rabbit anti-mouse IgG 1:3000, New England Biolabs, Ipswich, MA). Membranes were washed in TBST and incubated in Enhanced Chemiluminescent Western Blotting Substrate (ECL) (Pierce, Rockford, IL) for 5 min. Chemiluminescence was detected by exposure to film (ISC Bioexpress, Kaysville, UT). Protein expression from crude homogenates was normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) 1:1000, mms-580s, Covance or histone 2B 1:1000, ab45695, Abcam). A total of 51 animals were used for Western blot (24 for punches and 27 for whole medulla and CTX). A minimum of 3 samples from each behavioral state (SA, T, IBA) was run on each gel, and all gels were replicated a minimum of 3 times with samples from different animals run on each replication. Several antibodies to the GABAAR δ subunit displayed nonspecific banding in Western blots of rat tissues (Santa Cruz sc-25705, Santa Cruz sc-31438, Millipore AB9752). As there were no obvious differences in antigen affinity in squirrel tissues, we selected an antibody (Millipore AB9752) that has been used successfully in Western blots of rat Neurons in brainstem insensitive to ETOH, pentobarbital 10 hippocampus (28). For immunohistochemistry we selected an antibody to the GABAAR δ subunit raised in goat (Santa Cruz sc-31438) in order to colabel sections with antibodies made in rabbit and mouse. Quantitative RT-PCR Cortex and whole medulla samples were collected as described above. Samples were stored at -80 ̊C until homogenization in Trizol (Invitrogen, Carlsbad, CA). cDNA was synthesized from the extracted RNA with M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA). mRNA expression was normalized to GAPDH, the amplification of which did not vary significantly by behavioral state. Negative controls showed no detectable signal with any of the primer sets used, and each set displayed a single predominant peak in the dissociation curve at the expected melting temperature for each amplicon. The primer sequences were designed to span introns whenever possible to discount any product from genomic DNA. Primer specificity was assessed through NCBI BLAST analysis prior to use. Primer efficiency was tested through the use of serial dilutions. CT values from duplicate measurements were averaged, and relative expression levels were determined by the comparative CT method (26). In the absence of sequence data from squirrels, PCR primer sequences were derived from rat and mouse sequences and tested for their ability to amplify cDNA from squirrels. DNA oligos were synthesized by Integrated DNA Technologies (Coralville, IA). The following DNA oligos recognized highly conserved sequences and amplified appropriately: Neurons in brainstem insensitive to ETOH, pentobarbital 11 GAPDH forward primer: 5’ATGCCGCCTGGAGAAACC-3’, reverse primer: 5’GTAGCCCAGGATGCCCTTTAG-3’. GABAA α1 forward primer: 5’ATCACAGAGGATGGCACCTTGC-3’, reverse primer: 5’TGGGCATCCATAGGGAAGTCC-3’. GABAA α2 forward primer: 5’AGAACAACGCTTATGCAGTGGC-3’, reverse primer: 5’GTGGTTGCACTCTTGGAGATGG-3’. GABAA α3 forward primer: 5’AACCGGGAGTCAGCTATCAAGG-3’, reverse primer: 5’TTGGGTGCCTGTATGCTTC-3’. GABAA α4 forward primer: 5’GGTTTCTGCCAAGAAGGTACCC-3’, reverse primer: 5’TTTAAACAAACCGCCAGGCAC-3’. GABAA δ forward: 5’GTCTGCCTGGTTCCATGATGT -3’, reverse primer: 5’GGAGGTGATGCGGATGCT -3’. GABAA ε forward: 5’ACC TGA GCC TCA GCT GGA-3’, reverse primer: 5’-GGT CCG AGG CTG TTG ACA -3’. Synaptophysin forward primer: 5’CAGACAGGGAACACATGCAAGG-3’, reverse primer: 5’GGCCCAGCCTGTCTCCTTAAAC-3’. Quantitative RT-PCR was performed with a Prism Sequence Detection System (Model ABI 7000, Applied Biosystems, Foster City, CA). A total of 24 animals (8 each in SA, T, IBA) were used for RT-PCR. All samples were run in duplicate at an annealing temperature of 60 ̊C. After the final amplification cycle, a dissociation curve was generated to ensure that a single gene product was amplified. Samples were excluded on a well-by-well basis if contamination was evident when examining amplification plots. If samples were contaminated in control gene wells, the behavioral state mean for the control gene was used. By these criteria, only 2.2% of wells were excluded from the analysis. To confirm that the PCR-amplified DNA was the correct molecular weight, gel electrophoresis was used to analyze the PCR product for a highly conserved subunit (GABAAR α1; 49). Samples from each behavioral state (SA, T, IBA) and a DNA ladder (Promega, Madison, WI) were loaded on a 1% agarose gel (Biorad, Hercules, CA) and Neurons in brainstem insensitive to ETOH, pentobarbital 12 run at 60V for 2 h in a 1x Loenings buffer (4.36 mM Tris base, 15.44 mM NaH2PO4, 902.6 μM Na EDTA). The gel was subsequently stained with ethidium bromide (3 μg/mL, Biorad, Hercules, CA) for 10 min, and de-stained for 30 min in double distilled H2O. Gels were photographed on a UV box (Fotodyne, Hartland, WI). Immunohistochemistry Animals from each behavioral state (4 each in SA, T, IBA) were perfused with cold saline followed by 4% paraformaldehyde in PBS (pH 7.4). Fixed brains were cryoprotected with 30% sucrose and sectioned coronally (30 μm) on a freezing microtome. Eight matched sections were selected from the medulla of each squirrel at 60 μm intervals (equivalent to Bregma -13.9 to -13.1 mm in rat; 36). This is the location of the rVRG and cVRG in rat. Three matched sections were selected from the primary motor and somatosensory cortex (centered on the equivalent of Bregma -3.24 mm in rat). All medullary and cortical sections were reacted simultaneously. Sections were washed extensively in 0.01M PBS. After 1.0 h in blocking solution (10% normal donkey serum, NDS, in 0.01M PBS), primary antibodies were applied for 48 h at 4°C in blocking solution and 0.3% Triton X-100. Primary antibodies were used at 1:1000: anti GABAA ε (Abcam, ab35971, Cambridge, MA), anti GABAA δ (Santa Cruz, sc-31438, Santa Cruz, CA), anti GAD67 (Millipore, MAB5406, Temecula, CA). Alexa-Fluor conjugated secondary antibodies (568 donkey anti-goat IgG, 488 donkey anti-rabbit IgG, 647 donkey anti-mouse IgG; Invitrogen, Eugene, OR) were used at 1:300 in 1% NDS and 0.75% Triton X-100. Negative controls (2 medullary and 1 cortical section from each behavioral state) were reacted simultaneously with the omission of the primary antibody. Neurons in brainstem insensitive to ETOH, pentobarbital 13 Sections were mounted and coverslipped with Vectashield Hard Set mounting medium for fluorescence (Vector Laboratories, Burlingame, CA). There were no labeled cells in negative control slices from all behavioral states. Image acquisition and analysis All images were acquired during the same session using an Olympus Fluoview 500 laserscanning confocal system (Tokyo, Japan) mounted on an AX-70 upright microscope. Images were analyzed using ImageJ software (W. Rasband, National Institutes of Health, Bethesda, MD). Images were scanned with different wavelengths sequentially to prevent bleed-through. User-defined thresholds were applied uniformly to all images to measure the average pixel intensity, the number, and the area of particles. For quantitation, background fluorescence measured in negative control sections was subtracted from measurement of positive label. Data were normalized to the mean expression of label across all summer active sections. For figures, images were uniformly processed in Adobe Photoshop (Adobe Systems Incorporated, San Jose, CA) as follows: brightness levels adjusted, unsharp mask routine to improve edge detection, converted to 8-bit depth, and cropped. To quantify the number of neurons immunopositive for both GABAAR δ and glutamic acid decarboxylase 67 (GAD67, a marker of GABAergic neurons) in the VRC and its periphery, two images (635x635μm) were taken in anatomical center of the VRC bilaterally, based on anatomical landmarks with reference to the rat (37). Three additional images were taken on one side dorsolateral to the VRC where we previously determined Neurons in brainstem insensitive to ETOH, pentobarbital 14 that the majority of GABAAR δ-expressing neurons were localized (P1, P2, P3 in Supplemental Figure S1). Two investigators, blinded to the identity of sections, counted double-labeled cells in each image (4 images/section, 8 sections/animal, 4 animals/behavioral state). There was >95% concordance between the two investigators. When appropriate, a 2-way mixed ANOVA was used with a Tukey’s HSD post-hoc test to determine differences between regions and behavioral states. For non-parametric analyses, a Kruskal-Wallis rank sum test was used with subsequent post-hoc pair-wise tests if the chi-square p-value was <0.05. Electrophysiology A total of 17 animals (7 SA, 10 IBA) were used in electrophysiological studies. Electrophysiological experiments were conducted during the summer active months (May to July) and during naturally occurring IBAs (November to February) which ruled out temperature-dependent effects. Detailed methods can be found in Hengen et al. (22). Briefly, brains were removed and medullary and cortical slices (350 μm thick) were cut with a vibrating microtome (Campden Instruments, Layfayette, IN). Cortical slices contained primary motor and primary somatosensory areas while medullary slices contained the NTS and VRC (Fig. 1A,B). Slices were placed into an interface recording chamber (Warner Instruments, Hamden, CT) and subfused with warm artificial cerebrospinal fluid (aCSF, 37 ̊C) at a rate of 8 ml/min. Slices were maintained at 37 ̊C by an automated temperature controller (Harvard Apparatus, Holliston, MA). The composition of the aCSF was (in mM): 120 NaCl, 26 NaHCO3, 20 glucose, 2 MgSO4, 1.0 Neurons in brainstem insensitive to ETOH, pentobarbital 15 CaCl2, 1.25 Na2HPO4. To increase the yield of spontaneously active neurons, aCSF containing 9 mM KCl was used in all experiments. Previously, we determined that the GABAergic contributions to spontaneous activity were unaffected by the increased KCl concentration (22). Experimental protocol Spontaneous activity was recorded simultaneously from medullary and cortical slices from the same animal. Two 16-channel extracellular electrodes arrays (model a4x43mm100-177, Neuronexus, Ann Arbor, MI) were placed in the VRC, slightly ventrolateral to the nucleus ambiguus (Fig. 1A,B). One array was placed in the NTS, and one array was inserted perpendicular to the cortical layers, centered on layer 3. Slices were allowed to equilibrate in 9 mM KCl aCSF at 37 ̊C with electrodes inserted for 2 h. Baseline activity was then measured for 1 h, followed by sequential application of increasing doses of ETOH (0.001 M, 0.01 M, 0.1 M ETOH in aCSF) for 40 min each. To examine the contribution of GABAARs to the neuronal response to ETOH, a subset of slices were treated with bicuculline, a selective GABAAR antagonist, prior to ETOH application. Spontaneous activity was recorded from two medullary slices from each of 3 IBA animals. After equilibration, a baseline was established, followed by 60 min of 100 μM bicuculline application (Tocris Bioscience, Ellisville, MO). Slices were then treated with 100 μM bicuculline together with 0.1M ETOH.